Accéder au contenu
Merck

EHU094331

MISSION® esiRNA

targeting human MAPK11

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGTCCATCGAGGACTTCAGCGAAGTGTACTTGGTGACCACCCTGATGGGCGCCGACCTGAACAACATCGTCAAGTGCCAGGCGCTGAGCGACGAGCACGTTCAATTCCTGGTTTACCAGCTGCTGCGCGGGCTGAAGTACATCCACTCGGCCGGGATCATCCACCGGGACCTGAAGCCCAGCAACGTGGCTGTGAACGAGGACTGTGAGCTCAGGATCCTGGATTTTGGGCTGGCGCGCCAGGCGGACGAGGAGATGACCGGCTATGTGGCCACGCGCTGGTACCGGGCACCTGAGATCATGCTCAACTGGATGCATTACAACCAAACAGTGGATATCTGGTCCGTGGGCTGCATCATGGCTGAGCTGCTCCAGGGCAAGGCCCTCTTCCCGGGAAGCGACTACATTGACCAGCTGAAGCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAPK11(5600)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK
Xiaoyu Zhang et al.
Antiviral research, 167, 68-77 (2019-04-07)
Lassa virus (LASV) causes Lassa hemorrhagic fever in humans and poses a significant threat to public health in West Africa. Current therapeutic treatments for Lassa fever are limited, making the development of novel countermeasures an urgent priority. In this study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique