Accéder au contenu
Merck

EHU098591

MISSION® esiRNA

targeting human LRRK2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCACGAGCTTTCCACAACAGCTATGTGAAACTCTGAAGAGTTTGACACATTTGGACTTGCACAGTAATAAATTTACATCATTTCCTTCTTATTTGTTGAAAATGAGTTGTATTGCTAATCTTGATGTCTCTCGAAATGACATTGGACCCTCAGTGGTTTTAGATCCTACAGTGAAATGTCCAACTCTGAAACAGTTTAACCTGTCATATAACCAGCTGTCTTTTGTACCTGAGAACCTCACTGATGTGGTAGAGAAACTGGAGCAGCTCATTTTAGAAGGAAATAAAATATCAGGGATATGCTCCCCCTTGAGACTG

Ensembl | human accession no.

ENSG00000188906

NCBI accession no.

NM_198578

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... LRRK2(120892)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JUU
IBS
RPR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ji-Hye Yoon et al.
Biochimica et biophysica acta, 1864(12), 2356-2368 (2017-09-11)
Leucine-rich repeat kinase 2 (LRRK2), a multi-domain protein, is a key causative factor in Parkinson's disease (PD). Identification of novel substrates and the molecular mechanisms underlying the effects of LRRK2 are essential for understanding the pathogenesis of PD. In this
Zhongcan Chen et al.
Human molecular genetics, 26(22), 4494-4505 (2017-10-04)
Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself
Xiaodong Ding et al.
Neurobiology of disease, 98, 122-136 (2016-11-29)
Dominantly inherited mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common causes of familial Parkinson's disease (PD) and LRRK2 polymorphisms are associated with increased risk for idiopathic PD. However, the molecular mechanisms by which these mutations cause PD
Alexia F Kalogeropulou et al.
The Biochemical journal, 477(22), 4397-4423 (2020-11-03)
Mutations that enhance LRRK2 protein kinase activity cause inherited Parkinson's disease. LRRK2 phosphorylates a group of Rab GTPase proteins, including Rab10 and Rab12, within the effector-binding switch-II motif. Previous work has indicated that the PARK16 locus, which harbors the gene
Fieke Wauters et al.
Autophagy, 16(2), 203-222 (2019-04-05)
Parkinson disease (PD) is a disabling, incurable disorder with increasing prevalence in the western world. In rare cases PD is caused by mutations in the genes for PINK1 (PTEN induced kinase 1) or PRKN (parkin RBR E3 ubiquitin protein ligase)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique