Accéder au contenu
Merck

EHU108071

MISSION® esiRNA

targeting human SCD

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SCD(6319)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mohamed Amine Lounis et al.
Cancers, 12(11) (2020-11-15)
De novo lipogenesis (DNL) is now considered as a hallmark of cancer. The overexpression of key enzymes of DNL is characteristic of both primary and advanced disease and may play an important role in resistance to therapies. Here, we showed
Lei Li et al.
PloS one, 8(9), e75104-e75104 (2013-09-27)
Increased de novo lipogenesis is one of the major metabolic events in cancer. In human hepatocellular carcinoma (HCC), de novo lipogenesis has been found to be increased and associated with the activation of AKT/mTOR signaling. In mice, overexpression of an
Dawei Yao et al.
Journal of cellular physiology, 232(3), 635-649 (2016-06-25)
Stearoyl-CoA desaturase 1 (SCD1) is a key enzyme for the synthesis of the monounsaturated fatty acids (MUFA) palmitoleic acid and oleic acid. In non-ruminant species, SCD1 expression is known to be tightly regulated by a variety of transcription factors. Although
Youping Zhou et al.
Aging, 12(8), 7350-7362 (2020-04-24)
SCD1 is a key enzyme controlling lipid metabolism and a link between its activity and NAFLD has been proposed. Lipophagy is a novel regulatory approach to lipid metabolism regulation, which is involved in the development of NAFLD. However, the possible
Qian Wang et al.
Free radical biology & medicine, 164, 369-380 (2021-01-16)
Metastasis is the major cause of death in women with advanced ovarian cancer. Epithelial ovarian cancer cells can dissociate directly from extracellular matrix (ECM) and form spheroids to spread through the peritoneal cavity. Loss of ECM hinders the survival of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique