Accéder au contenu
Merck

EHU123221

MISSION® esiRNA

targeting human TP53

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mingyan Lin et al.
BMC systems biology, 10(1), 105-105 (2016-11-17)
Individuals with 22q11.2 Deletion Syndrome (22q11.2 DS) are a specific high-risk group for developing schizophrenia (SZ), schizoaffective disorder (SAD) and autism spectrum disorders (ASD). Several genes in the deleted region have been implicated in the development of SZ, e.g., PRODH
Yukihiro Furusawa et al.
Apoptosis : an international journal on programmed cell death, 22(10), 1225-1234 (2017-07-25)
Hyperthermia induced by heat stress (HS) is known to inhibit proliferation and induce cell death in cancer. We previously demonstrated that checkpoint kinase 1 (Chk1) contributes to G
Beilei Zhang et al.
Cancer letters, 459, 50-58 (2019-06-05)
MicroRNAs (miRNAs) were involved in cancer progression, and the targeting of miRNAs by natural agents has opened avenues for cancer treatment and drug development. miR-16 functions as a tumor suppressor and is frequently deleted or downregulated in various human cancers
Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Myriam Fezai et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2279-2288 (2017-05-01)
Injury by the sting of Lesser weever fish (Trachinus vipera) may lead to severe pain, edema or tissue necrosis. Cellular effects of the venom are still incompletely understood. Previous observations revealed that purified Lesser weever fish venom (LWFV) induces suicidal

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique