Accéder au contenu
Merck

EHU124131

MISSION® esiRNA

targeting human PKN1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTCACCTCTGACCCTCGAAGATTTCAAGTTCCTGGCGGTGCTGGGCCGGGGTCATTTTGGGAAGGTGCTCCTCTCCGAATTCCGGCCCAGTGGGGAGCTGTTCGCCATCAAGGCTCTGAAGAAAGGGGACATTGTGGCCCGAGACGAGGTGGAGAGCCTGATGTGTGAGAAGCGGATATTGGCGGCAGTGACCAGTGCGGGACACCCCTTCCTGGTGAACCTCTTCGGCTGTTTCCAGACACCGGAGCACGTGTGCTTCGTGATGGAGTACTCGGCCGGTGGGGACCTGATGCTGCACATCCACAGCGACGTGTTCTCTGAGCCCCGTGCCATCTTTTATTCCGCCTGCGTGGTGCTGGGCCTACAGTTTCTTCACGAACACAAGATCGTCTACAGGGACCTGAAGTTGGACAATTTGCTCCTGGACACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique