Accéder au contenu
Merck

EHU130851

MISSION® esiRNA

targeting human EGF

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCAT

Ensembl | human accession no.

ENSG00000138798

NCBI accession no.

NM_001963

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
IBS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mingli Duan et al.
Molecular medicine reports, 18(2), 1651-1659 (2018-05-31)
Migration and invasion are the most important characteristics of human malignancies which limit cancer drug therapies in the clinic. Tongue squamous cell carcinoma (TSCC) is one of the rarest types of cancer, although it is characterized by a higher incidence
Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Ding Zhang et al.
Clinical and translational medicine, 10(8), e231-e231 (2020-12-31)
Acute lung injury is a serious form and major cause of patient death and still needs efficient therapies. The present study evidenced that co-transplantation of mesenchymal stem cells (MSCs) and telocytes (TCs) improved the severity of experimental lung tissue inflammation
Cuijie Li et al.
Journal of cellular physiology, 236(4), 2881-2892 (2020-11-25)
Intestinal mucosal injury is one of the most significant complications of burns. In our previous study, it was found that autophagy could alleviate burn-induced intestinal injury, but the underlying mechanisms are still unclear. Irregular expression of long noncoding RNAs (lncRNAs)
Dongqing Li et al.
The Journal of clinical investigation, 125(8), 3008-3026 (2015-06-30)
Wound healing is a complex process that is characterized by an initial inflammatory phase followed by a proliferative phase. This transition is a critical regulatory point; however, the factors that mediate this process are not fully understood. Here, we evaluated
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique