Accéder au contenu
Merck

EHU131171

MISSION® esiRNA

targeting human USP7

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGTGACTTGCTCCCAGTTATGTGTGACAGAGCAGGATTTATTCAAGATACTAGCCTTATCCTCTATGAGGAAGTTAAACCGAATTTAACAGAGAGAATTCAGGACTATGACGTGTCTCTTGATAAAGCCCTTGATGAACTAATGGATGGTGACATCATAGTATTTCAGAAGGATGACCCTGAAAATGATAACAGTGAATTACCCACCGCAAAGGAGTATTTCCGAGATCTCTACCACCGCGTTGATGTCATTTTCTGTGATAAAACAATCCCTAATGATCCTGGATTTGTGGTTACGTTATCAAATAGAATGAATTATTTTCAGGTTGCAAAGACAGTTGCACAGAGGCTCAACACAGATCCAATGTTGCTGCAGTTTTTCAAGTCTCAAGGTTATAGGGATGGCCCAGGT

Ensembl | human accession no.

ENSG00000187555

NCBI accession no.

NM_003470

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Catégories apparentées

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
XZU
ZYU
QCS
FQR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yufei Wang et al.
EMBO reports, 20(7), e47563-e47563 (2019-07-04)
Monoubiquitination of histone H2B on lysine 120 (H2Bub1) is an epigenetic mark generally associated with transcriptional activation, yet the global functions of H2Bub1 remain poorly understood. Ferroptosis is a form of non-apoptotic cell death characterized by the iron-dependent overproduction of
Xiaomeng Dai et al.
Theranostics, 10(20), 9332-9347 (2020-08-18)
Background: Tumor associated macrophages (TAMs) have strong plasticity and if reprogrammed, can clear tumor cells and regulate the adaptive immune system for cancer immunotherapy. Deubiquitinating enzymes (DUBs), which can remove ubiquitin (Ub) from Ub-modified substrates, have been associated with oncogenic
Eduardo de la Vega et al.
The FEBS journal, 287(21), 4659-4677 (2020-03-03)
Satellite cells (SCs) are myogenic progenitors responsible for skeletal muscle regeneration and maintenance. Upon activation, SCs enter a phase of robust proliferation followed by terminal differentiation. Underlying this myogenic progression, the sequential expression of muscle regulatory transcription factors (MRFs) and
Peiyi Xie et al.
Molecular and cellular endocrinology, 518, 111037-111037 (2020-09-24)
Ubiquitin-specific protease 7 (USP7/HAUSP) is known to regulate multiple cellular phenomena, including cell cycle progression and proliferation, and is involved in binding and stabilizing specific target proteins through deubiquitylation. However, the detailed role of USP7 in papillary thyroid carcinoma (PTC)
Keith Wheaton et al.
The Journal of biological chemistry, 292(7), 2893-2902 (2017-01-12)
UbE2E1/UbcH6 is an E2 ubiquitin-conjugating enzyme that is regulated by USP7. We identified UbE2E1 as a novel component of Polycomb repressive complex 1 (PRC1), the E3 ligase complex responsible for histone H2A ubiquitination and gene silencing. We demonstrate that UbE2E1
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique