Accéder au contenu
Merck

EHU132681

MISSION® esiRNA

targeting human IFI16

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTCCACCCAACAGTTCTTCAACTGAGAACCCGAAAACAGTGGCCAAATGTCAGGTAACTCCCAGAAGAAATGTTCTCCAAAAACGCCCAGTGATAGTGAAGGTACTGAGTACAACAAAGCCATTTGAATATGAGACCCCAGAAATGGAGAAAAAAATAATGTTTCATGCTACAGTGGCTACACAGACACAGTTCTTCCATGTGAAGGTTTTAAACACCAGCTTGAAGGAGAAATTCAATGGAAAGAAAATCATCATCATATCAGATTATTTGGAATATGATAGTCTCCTAGAGGTCAATGAAGAATCTACTGTATCTGAAGCTGGTCCTAACCAAACGTTTGAGGTTCCAAATAAAATCATCAACAGAGCAAAGGAAACTCTGAAGATTGATATTCTTCACAAACAAGCTTCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cindy Orvain et al.
The Journal of clinical investigation, 130(7), 3777-3790 (2020-04-03)
Hidradenitis suppurativa (HS) is a chronic, relapsing, inflammatory skin disease. HS appears to be a primary abnormality in the pilosebaceous-apocrine unit. In this work, we characterized hair follicle stem cells (HFSCs) isolated from HS patients and more precisely the outer
Stine Søby et al.
Herpesviridae, 3(1), 6-6 (2012-10-16)
Innate recognition is essential in the antiviral response against infection by herpes simplex virus (HSV). Chemokines are important for control of HSV via recruitment of natural killer cells, T lymphocytes, and antigen-presenting cells. We previously found that early HSV-1-mediated chemokine
A Berry et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 24(6), 1700-1713 (2010-01-21)
Previously, we used cDNA expression profiling to identify genes associated with glucocorticoid (Gc) sensitivity. We now identify which of these directly influence Gc action. Interferon-inducible protein 16 (IFI16), bone morphogenetic protein receptor type II (BMPRII), and regulator of G-protein signaling
Yuanyuan Yang et al.
Hepatology (Baltimore, Md.), 71(4), 1154-1169 (2019-08-14)
Nuclear-located covalently closed circular DNA (cccDNA) of hepatitis B virus (HBV) is a determining factor for HBV persistence and the key obstacle for a cure of chronic hepatitis B. However, it remains unclear whether and how the host immune system
Xin Duan et al.
PloS one, 6(5), e19532-e19532 (2011-05-17)
Glucose restriction in cells increases the AMP/ATP ratio (energetic stress), which activates the AMPK/p53 pathway. Depending upon the energetic stress levels, cells undergo either autophagy or cell death. Given that the activated p53 induces the expression of IFI16 protein, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique