Accéder au contenu
Merck

EHU133471

MISSION® esiRNA

targeting human MAPK7

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGTGACCCAGCAGCTATCTAAGTCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... MAPK7(5598)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Abrar Ul Haq Khan et al.
Scientific reports, 7(1), 10654-10654 (2017-09-08)
Controlling cholesterol levels is a major challenge in human health, since hypercholesterolemia can lead to serious cardiovascular disease. Drugs that target carbohydrate metabolism can also modify lipid metabolism and hence cholesterol plasma levels. In this sense, dichloroacetate (DCA), a pyruvate
Yan Huang et al.
Tumori, 103(5), 483-488 (2016-10-30)
Osteosarcoma (OS) is the most common primary bone tumor and has low cure rates. Our study aimed to evaluate the roles of mitogen-activated protein kinase 7 (MAPK7) in cell proliferation, migration and invasion using the SOSP-M human OS cell line
Byambasuren Vanchin et al.
The Journal of pathology, 247(4), 456-470 (2018-12-20)
Endothelial-mesenchymal transition occurs during intimal hyperplasia and neointima formation via mechanisms that are incompletely understood. Endothelial MAPK7 signaling is a key mechanosensitive factor that protects against endothelial-mesenchymal transition, but its signaling activity is lost in vessel areas that are undergoing
Abrar Ul Haq Khan et al.
Scientific reports, 8(1), 7420-7420 (2018-05-11)
Oxidative phosphorylation (OXPHOS) generates ROS as a byproduct of mitochondrial complex I activity. ROS-detoxifying enzymes are made available through the activation of their antioxidant response elements (ARE) in their gene promoters. NRF2 binds to AREs and induces this anti-oxidant response.
Dae-Hwan Nam et al.
Molecules and cells, 40(7), 457-465 (2017-07-07)
Streptozotocin (STZ)-induced murine models of type 1 diabetes have been used to examine ER stress during pancreatic β-cell apoptosis, as this ER stress plays important roles in the pathogenesis and development of the disease. However, the mechanisms linking type 1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique