Accéder au contenu
Merck

EHU143071

MISSION® esiRNA

targeting human BAG3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAGAAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTGGCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGCCCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCTCCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGGGGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCTGATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCCGAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGACCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... BAG3(9531)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fei Song et al.
Oncotarget, 8(56), 95392-95400 (2017-12-10)
Bcl2-associated athanogene 3 (BAG3) has been reported to be involved in aggressive progression of many tumors. In the present study, we examined the expression of BAG3 in human cervical cancer (CC) tissues and investigated the role of BAG3 in SiHa
Patrick Antonietti et al.
Molecular cancer therapeutics, 16(1), 156-168 (2016-10-26)
Malignant gliomas exhibit a high intrinsic resistance against stimuli triggering apoptotic cell death. HSF1 acts as transcription factor upstream of HSP70 and the HSP70 co-chaperone BAG3 that is overexpressed in glioblastoma. To specifically target this resistance mechanism, we applied the
Joseph M McClung et al.
Circulation, 136(3), 281-296 (2017-04-27)
Critical limb ischemia is a manifestation of peripheral artery disease that carries significant mortality and morbidity risk in humans, although its genetic determinants remain largely unknown. We previously discovered 2 overlapping quantitative trait loci in mice, We treated mice with
Shuang Qiu et al.
Oncology reports, 38(1), 309-316 (2017-06-20)
Ovarian cancer is the most lethal disease among all gynecological malignancies. Interval cytoreductive surgery and cisplatin‑based chemotherapy are the recommended therapeutic strategies. However, acquired resistance to cisplatin remains a big challenge for the overall survival and prognosis in ovarian cancer.
Shuang Qiu et al.
Oncology letters, 18(2), 1969-1978 (2019-08-20)
Epithelial ovarian cancer (EOC) is one of the most common malignant gynecological tumors. Interval cytoreductive surgery and cisplatin-based chemotherapy are the standard treatments. However, acquired resistance to cisplatin presents a major challenge for improving the overall survival and prognosis of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique