EHU146141
MISSION® esiRNA
targeting human RNF8
Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGACTTTGTCCTTTGTGGATTGCATAGCTGGATACCCATCATCTGTTTCTCTGATTGGAAGCTGCTGTTGTACAGAAAGACCTGCATTTCCCCCTTGTCTCCAGTTCTCTCACTACTTTTTCCTCCTCTGTGAGTGACCATCCAGGCAGTCACCATAACTGCTGGAGTGTCTGGGATTGGTAGCTCTCTCCAACTGCCTGCTTGCTCTTTACAGCCTCTCTCTGTGACTGGAATCTCTCCACCTCATCGTATCTAAGGATAACCCAGAAACATGGGGTGTCCTAGGTATGTTTATCTCGACACTGAACCCCCTAGGCTTCTGATGAATCCAGTGATTAGCTAAATTTGACATAGAAAGTAAGAAGGAATGTCTACTTTGTATTGTGGTCCTAATCTAAGATCAGGAGAATCCTGGAATTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RNF8(9025)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Lu Min et al.
Acta biochimica et biophysica Sinica, 51(8), 791-798 (2019-07-12)
MicroRNAs (miRNAs) are a class of endogenous noncoding genes that regulate gene expression at the posttranscriptional level. In recent decades, miRNAs have been reported to play important roles in tumor growth and metastasis, while some reported functions of a specific
Yoshiyuki Sasaki et al.
International journal of medical sciences, 10(9), 1231-1241 (2013-08-13)
The optimal timing of surgical resection of liver metastasis remains controversial, and guidelines regarding the upper limits of operative indications have not yet been defined. Surgical indication for metastasis from colorectal cancer (CLM) based on results of preoperative chemotherapy and
Justine Sitz et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(39), 19552-19562 (2019-09-11)
High-risk human papillomaviruses (HR-HPVs) promote cervical cancer as well as a subset of anogenital and head and neck cancers. Due to their limited coding capacity, HPVs hijack the host cell's DNA replication and repair machineries to replicate their own genomes.