Accéder au contenu
Merck

EHU152091

MISSION® esiRNA

targeting human CASP8

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human CASP8

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAAAGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTCAGCAAAGAGAGAAGCAGCAGCCTTGAAGGAAGTCCTGATGAATTTTCAAATGACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAACAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAGGAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGAGATCAAGCCCC

Ensembl | human accession no.

ENSG00000064012

NCBI accession no.

NM_001080124

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... CASP8(841), CASP8(841)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
ZRU
WRU
LET
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bin Xu et al.
Oncology research, 25(7), 1161-1168 (2017-01-22)
Currently, multiple microRNAs (miRNAs) have been found to play vital roles in the pathogenesis of osteosarcoma. This study aimed to investigate the role of miR-21 in osteosarcoma. The level of miR-21 in 20 pairs of osteosarcoma and corresponding adjacent tissues
Hai-Yan Jia et al.
BMC molecular and cell biology, 20(1), 46-46 (2019-10-30)
It was reported that microRNA-21(miR-21) was differentially expressed in the keratinocytes of psoriasis patients, and it may influence the apoptosis and proliferation of cells. The role of lncRNA maternally expressed gene3 (MEG3), a competing endogenous RNAs of miR-21, in the
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Jong-Heon Won et al.
Molecules (Basel, Switzerland), 23(12) (2018-12-16)
The natural product 23-hydroxyursolic acid (23-HUA) is a derivative of ursolic acid, which is known to induce cancer cell apoptosis. However, apoptotic effects and mechanisms of 23-HUA have not been well characterized yet. Herein, we investigated the molecular mechanisms of
Nyree Crawford et al.
Cell death and differentiation, 25(11), 1952-1966 (2018-03-04)
Apoptosis resistance contributes to treatment failure in colorectal cancer (CRC). New treatments that reinstate apoptosis competency have potential to improve patient outcome but require predictive biomarkers to target them to responsive patient populations. Inhibitor of apoptosis proteins (IAPs) suppress apoptosis
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique