Accéder au contenu
Merck

EHU155791

MISSION® esiRNA

targeting human RIPK1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human RIPK1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTCACATGGCTTTGGAACAAGACCACTGGATCCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTGCATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGCTCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAGATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACAAATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACTAGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAACTGTGCCCGTAAA

Ensembl | human accession no.

ENSG00000137275

NCBI accession no.

NM_003804

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... RIPK1(8737), RIPK1(8737)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JUU
DZT
CLT
SXS
WNS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Norberto Gonzalez-Juarbe et al.
Scientific reports, 8(1), 5846-5846 (2018-04-13)
Pore-forming toxins are the most common virulence factor in pathogenic bacteria. They lead to membrane permeabilization and cell death. Herein, we show that respiratory epithelial cells (REC) undergoing bacterial pore-forming toxin (PFT)-induced necroptosis simultaneously experienced caspase activation independently of RIPK3.
Nyree Crawford et al.
Cell death and differentiation, 25(11), 1952-1966 (2018-03-04)
Apoptosis resistance contributes to treatment failure in colorectal cancer (CRC). New treatments that reinstate apoptosis competency have potential to improve patient outcome but require predictive biomarkers to target them to responsive patient populations. Inhibitor of apoptosis proteins (IAPs) suppress apoptosis
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique