Accéder au contenu
Merck

EHU158531

MISSION® esiRNA

targeting human E2F6

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAACTGATGGCATTTGAGAATTTATGTATCACTGAGTTTTTTGGGAATATCTTCGTGGAGAATTACGCATCAAATTTGATTCTCAGAGCAATAAATTATCCATGAAGTGCTCTCGTTCTCAGTAGCGGCATCATGGCCAGTAGTGTCTTTGAGGAGTTCACCACTTAGATTACTGAGTAATTGTGGTTTCCACATTTGAAAACAACTCCTTTTATAATTATTCACTGCTTTTTGTCAGTGAAATAGACATCTTGCCTCCTGAAGTAGCTTCATCACAGAGTGTCATGAAGACAGACAGTCAGGCTGAAATGGACAGTTCTTTGTGGACTCTACCCTTCCCTTCAAGGAGTATGTCATATATCACAAAAGAAATTGCCTTACACTGGTTCATGTTTGCAGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports
Betheney R Pennycook et al.
Nature communications, 11(1), 3503-3503 (2020-07-16)
DNA replication timing is tightly regulated during S-phase. S-phase length is determined by DNA synthesis rate, which depends on the number of active replication forks and their velocity. Here, we show that E2F-dependent transcription, through E2F6, determines the replication capacity

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique