Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACGCAGCCACTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGGGCAGAAAATACAGCATTTTCACAGAGAAGGACGAAATCTTGTCTGATGTTGCATCCAGACTTTGGTTTACATACAGGAGAAACTTTCCAGCTATTGGGGGAACTGGCCCTACTTCAGACACAGGCTGGGGTTGCATGCTTCGGTGTGGACAGATGATCTTTGCCCAGGCCCTGGTATGCCGGCACTTAGGTCGAGATTGGAGGTGGACTCAGCGGAAGAGGCAGCCTGACAGCTACTTTAATGTCCTCAATGCTTTCCTCGACAGGAAGGACAGCTACTATTCCATCCATCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCTA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ATG4B(66615), Atg4b(66615)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Katharina Rothe et al.
Blood, 123(23), 3622-3634 (2014-04-24)
Previous studies demonstrated that imatinib mesylate (IM) induces autophagy in chronic myeloid leukemia (CML) and that this process is critical to cell survival upon therapy. However, it is not known if the autophagic process differs at basal levels between CML
Pei-Feng Liu et al.
Autophagy, 10(8), 1454-1465 (2014-07-06)
Autophagy is reported to suppress tumor proliferation, whereas deficiency of autophagy is associated with tumorigenesis. ATG4B is a deubiquitin-like protease that plays dual roles in the core machinery of autophagy; however, little is known about the role of ATG4B on