Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderQuality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAAGCAGTGCACAGATAAGCGGATTAGAACCAATCTCTTACAGGTATGCGAGCGAATCCCAACTATAAGCACCCAGCTCAAAATCCTATCCACAGTGAAGGCCACTATGCTGGGCCGGACCAACATCAGTGATGAGGAGTCTGAGCAGGCCACAGAGATGCTGGTTCATAATGCCCAGAACCTCATGCAGTCTGTGAAGGAGACTGTGCGAGAGGCTGAAGCTGCTTCAATCAAAATCCGAACAGATGCTGGCTTTACTCTGCGCTGGGTCAGAAAGACTCCCTGGTACCAGTAGGCACCTCGTCAAATCTGGCTGGTACATACACCTCTGCTAAAGAGAAGGGAACCATCTTGAGTTCCAGAAGCCATTCAGAGTTGTCAGGAATGGAAACATCAATCCCTGGCTTCAC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... VCL(22330), Vcl(22330)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Matthew G Rubashkin et al.
Cancer research, 74(17), 4597-4611 (2014-09-04)
Extracellular matrix (ECM) stiffness induces focal adhesion assembly to drive malignant transformation and tumor metastasis. Nevertheless, how force alters focal adhesions to promote tumor progression remains unclear. Here, we explored the role of the focal adhesion protein vinculin, a force-activated
Ryuichi Fukuda et al.
Developmental cell, 51(1), 62-77 (2019-09-10)
Mechanical forces regulate cell behavior and tissue morphogenesis. During cardiac development, mechanical stimuli from the heartbeat are required for cardiomyocyte maturation, but the underlying molecular mechanisms remain unclear. Here, we first show that the forces of the contracting heart regulate