Accéder au contenu
Merck

EMU026991

MISSION® esiRNA

targeting mouse Mdm2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTTGGAGTCCCGAGTTTCTCTGTGAAGGAGCACAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTGAGTGAGAGCAGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCGCCACCAGAAGAGAAACCTTCATCTTCTGATTTAATTTCTAGACTGTCTACCTCATCTAGAAGGAGATCCATTAGTGAGACAGAAGAGAACACAGATGAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTTGATCCGAGCCTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCGAGTCCACAGAGACGCCCTCGCATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTGGATCAGGAT

Ensembl | mouse accession no.

ENSMUSG00000020184

NCBI accession no.

NM_010786

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... MDM2(17246), Mdm2(17246)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
TMU
CHU
WBU
QUT
OCT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shaneabbas Raza et al.
Molecular and cellular biochemistry, 410(1-2), 187-195 (2015-09-10)
Estrogen is synthesized from cholesterol and high cholesterol levels are suggested to be associated with increased risk of estrogen receptor(ER)-positive breast cancer. The cholesterol metabolite 27-hydroxycholesterol (27-OHC) was recently identified as a selective estrogen receptor modulator (SERM) and may therefore
Eva Slabáková et al.
Oncotarget, 6(34), 36156-36171 (2015-09-30)
Plasticity of cancer cells, manifested by transitions between epithelial and mesenchymal phenotypes, represents a challenging issue in the treatment of neoplasias. Both epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) are implicated in the processes of metastasis formation and acquisition of
Hong Zhu et al.
Oncotarget, 6(5), 3254-3267 (2014-09-17)
Adriamycin, a widely used anthracycline antibiotic in multiple chemotherapy regimens, has been challenged by the cardiotoxicity leading to fatal congestive heart failure in the worst condition. The present study demonstrated that Dihydromyricetin, a natural product extracted from ampelopsis grossedentat, exerted
Jiang-Jiang Qin et al.
Oncotarget, 6(5), 2623-2640 (2015-03-05)
The MDM2 oncogene has been suggested as a molecular target for treating human cancers, including breast cancer. Most MDM2 inhibitors under development are targeting the MDM2-p53 binding, and have little or no effects on cancers without functional p53, such as
Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique