Accéder au contenu
Merck

EMU052231

MISSION® esiRNA

targeting mouse Park7

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCAGTGTAGCCGTGATGTAATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCAGGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGAGCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGGATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAGAGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAGCCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACTAGAGCCCAAGCCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Jung-Min Kim et al.
Scientific reports, 4, 4805-4805 (2014-06-14)
Adipose tissue functions as an endocrine organ, and the development of systemic inflammation in adipose tissue is closely associated with metabolic diseases, such as obesity and insulin resistance. Accordingly, the fine regulation of the inflammatory response caused by obesity has
Ismail Ahmed Ismail et al.
Journal of cellular physiology, 230(9), 2262-2269 (2015-02-14)
2'-Benzoyloxycinnamaldehyde (BCA) is a promising antitumor agent. BCA effectively inhibited proliferation of MDA-MB-435 more than in MCF-7 breast cancer cells. Our recent findings showed that DJ-1 protects MCF7 cells from BCA-induced oxidative stress via its mitochondrial translocation and inhibition of
Hong Zhu et al.
Free radical biology & medicine, 71, 121-132 (2014-04-01)
Dihydroartemisinin (DHA), one of the main metabolites of artemisinin and its derivatives, presents anti-cancer potential in vitro and in vivo. To explore the mechanisms of resistance toward DHA, a DHA-resistant cell line, HeLa/DHA, was established with a resistance factor of