Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCTTCGGAGTTGAAGTCTCCAGCGTCTTCATCTGCGCCCCCCATAAGCTCCGGGCCAGGGGCGCTGGCATCTGTACCCCCCTCTCACCCGGCTCACGGCCTGGCACCCCACGAATCTCAGCTGCATCTGAAAGGGGATCCCCGCTACTCCTTTAATCACCCCTTCTCCATCAACAACCTCATGTCCTCCTCCGAGCAACAGCACAAGCTGGACTTCAAGGCATACGAGCAGGCGCTGCAGTACTCTCCTTATGGCGCTACCTTGCCCGCCAGTCTGCCCCTTGGCAGCGCCTCAGTGGCCACGAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCAGCCTACTACCAAGGTGTGTATTCCAGACCCGTGCTAAATACTTCCTAGCTCCCAGAACTGAGGGTTTTGTCTGCATG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FOXA1(15375), Foxa1(15375)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Wenhuan Guo et al.
The Prostate, 75(9), 976-987 (2015-03-27)
ELL-associated factor 2 (EAF2) is an androgen-regulated tumor suppressor in the prostate. However, the mechanisms underlying tumor suppressive function of EAF2 are still largely unknown. Identification of factors capable of modulating EAF2 function will help elucidate the mechanisms underlying EAF2
Tuanhui Chen et al.
Experimental cell research, 326(2), 326-335 (2014-05-08)
Transcription factor Foxa1 plays a critical role during neural differentiation and is induced immediately after retinoic acid (RA)-initiated differentiation of pluripotent P19 embryonal carcinoma cells, correlated with the downregulated expression of pluripotency-related genes such as Nanog. To study whether Foxa1