Accéder au contenu
Merck

EMU075181

MISSION® esiRNA

targeting mouse E2f1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGAGCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Wanghao Chen et al.
Journal of neuro-oncology, 120(1), 43-53 (2014-08-21)
MicroRNAs (miRNAs) have gained much attention due to their critical roles in diverse biological events, including tumorigenesis. In this study, we demonstrate that miR-136 is down-regulated in two cohorts of patients with glioma. Furthermore, the low-level expression of miR-136 is
Xiaolei Jiang et al.
PloS one, 10(6), e0127951-e0127951 (2015-06-04)
The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the
T J Kaitu'u-Lino et al.
Placenta, 36(8), 932-937 (2015-07-07)
Preeclampsia is a serious complication of pregnancy for which there are no efficacious medical treatments. Soluble endoglin is as an anti-angiogenic factor that contributes to the pathogenesis of the disease, however little is known about its molecular regulation in placenta.