Accéder au contenu
Merck

EMU094061

MISSION® esiRNA

targeting mouse Atg7

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting mouse Atg7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTTCTGCTCCTGACCTTCGCGGACCTAAAGAAGTACCACTTCTACTACTGGTTTTGCTGCCCCGCCCTCTGTCTTCCTGAGAGCATCCCTCTAATCCGGGGACCTGTGAGCTTGGATCAAAGGCTTTCACCAAAACAGATCCAGGCCCTGGAGCATGCCTATGATGATCTGTGTCGAGCCGAAGGCGTCACGGCCCTGCCCTACTTCTTATTCAAGTACGATGACGACACTGTTCTGGTCTCCTTGCTCAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACAAAGATAACAGTTGGTGTGTACGATCCCTGTAACCTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTGGCAGCCCACAGATGGAGCGGCAGTTTCCAGTCCGTTGAAGTCC

Ensembl | mouse accession no.

ENSMUSG00000030314

NCBI accession no.

NM_028835

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... ATG7(74244), Atg7(74244)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JDV
USS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bingrong Tang et al.
PloS one, 9(7), e103364-e103364 (2014-07-26)
The two major intracellular protein degradation systems, the ubiquitin-proteasome system (UPS) and autophagy, work collaboratively in many biological processes including development, apoptosis, aging, and countering oxidative injuries. We report here that, in human retinal pigment epithelial cells (RPE), ARPE-19 cells
Hong-Guang Xia et al.
The Journal of cell biology, 210(5), 705-716 (2015-09-02)
Hexokinase II (HK2), a key enzyme involved in glucose metabolism, is regulated by growth factor signaling and is required for initiation and maintenance of tumors. Here we show that metabolic stress triggered by perturbation of receptor tyrosine kinase FLT3 in
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Marco B E Schaaf et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 114(3), 406-412 (2015-03-18)
(Pre)clinical studies indicate that autophagy inhibition increases response to anti-cancer therapies. Although promising, due to contradicting reports, it remains unclear if radiation therapy changes autophagy activity and if autophagy inhibition changes the cellular intrinsic radiosensitivity. Discrepancies may result from different
Rong Zheng et al.
Oncotarget, 6(19), 17417-17429 (2015-05-31)
Radiation therapy has an important role in the treatment of breast cancer. Dysfunction p53 and hypoxia are typical biological characteristics of breast cancer that constitute barriers to the efficacy of radiotherapy. Mitophagy plays a protective role in cellular homeostasis under
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique