description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTEN(5728)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
保管分類
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
資料
Quantitative and qualitative western blotting to validate knockdown by esiRNA.
Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Hu Gao et al.
Reproduction (Cambridge, England) (2019-11-23)
Sertoli cells are indispensable for normal spermatogenesis and increasing evidence has shown that microRNAs (miRNAs) participate in the regulation of Sertoli cell growth. However, the functions and regulatory mechanisms of miRNAs in Sertoli cells of domestic animals have not been
Ye Wang et al.
OncoTargets and therapy, 13, 1909-1919 (2020-03-19)
Berberine (BBR), a traditional Chinese medicine, has been shown effects on inhibiting cancer development. Autophagy-mediated resistance plays an important role in cancer progression; therefore, regulation of autophagy is a novel therapeutic strategy for cancer treatment. However, effects of BBR on