Skip to Content
Merck

EHU092111

MISSION® esiRNA

targeting human FUS

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACGTCATGACTCCGAACAGGATAATTCAGACAACAACACCATCTTTGTGCAAGGCCTGGGTGAGAATGTTACAATTGAGTCTGTGGCTGATTACTTCAAGCAGATTGGTATTATTAAGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGAGAGGCAACGGTCTCTTTTGATGACCCACCTTCAGCTAAAGCAGCTATTGACTGGTTTGATGGTAAAGAATTCTCCGGAAATCCTATCAAGGTCTCATTTGCTACTCGCCGGGCAGACTTTAATCGGGGTGGTGGCAATGGTCGTGGAGGCCGAGGGCGAGGAGGACCCATGGGCCGTGGAGGCTATGGAGGTGGTGGCAGTGGTGGTGGTGGCCGAGGAGGATTTCCCAGTGGAGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FUS(2521)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Lisa Gasperini et al.
Molecular biology of the cell, mbcE18020108-mbcE18020108 (2018-10-26)
RALY is a member of the heterogeneous nuclear ribonucleoprotein family whose transcriptome and interactome have been recently characterized. RALY binds poly-U rich elements within several RNAs and regulates the expression as well as the stability of specific transcripts. Here we
Haibo Wang et al.
Nature communications, 9(1), 3683-3683 (2018-09-13)
Genome damage and defective repair are etiologically linked to neurodegeneration. However, the specific mechanisms involved remain enigmatic. Here, we identify defects in DNA nick ligation and oxidative damage repair in a subset of amyotrophic lateral sclerosis (ALS) patients. These defects
Michail S Kukharsky et al.
Molecular neurodegeneration, 10, 20-20 (2015-04-19)
Mutations in calcium-responsive transactivator (CREST) encoding gene have been recently linked to ALS. Similar to several proteins implicated in ALS, CREST contains a prion-like domain and was reported to be a component of paraspeckles. We demonstrate that CREST is prone