Skip to Content
Merck

EMU014271

MISSION® esiRNA

targeting mouse Smad3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCGTATGAGCTTCGTCAAAGGCTGGGGAGCAGAGTACAGGAGACAGACAGTGACCAGCACCCCCTGCTGGATTGAGCTACACCTGAATGGACCCTTGCAGTGGCTTGTCAAGGTCCTCACCCAGATGGGTTCCCCGAGCATCCGCTGTTCCAGTGTGTCTTAGAGACACTAGGAGTAAAGGGAGCGGGTTGGGGAGGGCGGGCTTGGGGAAAATGACCTTGGAAGAGAACTCCATCCAACTTGGTCTTGTCAAAGAACACCGATTCCACTCAACTAAGGCACCAGCCTGTTTCTGAGACCACAGAAGAAAACCCCAGGGATGGATTTATGAACAGCTGTGTCTGCTACATACACGTGCCCCTGTCTGAAGGCCAAGTGATGGCTTCTGTTCTGGTGGCTTGAACTAACAGGTGGTGTATCGCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
A Sakoguchi et al.
Clinical and experimental rheumatology, 32(6 Suppl 86) (2014-06-25)
The toll-like receptor (TLR) family is thought to be expressed in many cell types in the skin and play a role in various diseases. The expression pattern and role of TLRs in systemic sclerosis (SSc) is to be clarified. We

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service